![]() |
| The Melba Ketchum Paper is being reviewed, what do other academics think? |
We pulled out some of Dr. Kokjohn's questions, but also provided the email from Dr. Kokjohn so you can see the questions in context.
- What happened to the original founder species?
- The Hybrids are abundant, yet the founder species is extinct?
- How could a hypothetical species so close to modern humans to interbreed and produce viable, fertile offspring not share homology to the same entities in their extended family?
- Where did the sequences not in GenBank originate?
Dr. Kokjohn's Letter:
Guy –Dr. Kokjohn added, "I am not impressed with the data I have seen, but from that I draw no conclusions regarding the existence or non-existence of Bigfoot."
Unfortunately, this pdf does not include supplementary data, so it is really hard to figure out how much of this I wish to deem reliable. The authors will have to grant reviewers the ability to view the sequences and run their own analyses at some point. Under the circumstances, I can’t say any of it is convincing evidence of a new species.
The authors proffer quite an interesting story; a male from an unknown species mates with a human female to ultimately establish a new hybrid species. But, based on the fact that they report finding 16 distinct human mitochondrial haplotypes in North America alone, such events must have occurred rather frequently and freely. Then I have to ask, what happened to the original founder species? NONE of them survive, but the hybrids are still extant? You would still think that out there somewhere would be some individuals harboring maternal mitochondrial DNA from the original species. That every one of them had only pure human mtDNA suggests a quite unique segregation followed and was maintained after the founding events, a minimum of 16 separate times. And all that human mtDNA remained unchanged no less. It is also hard to understand what they are asserting when telling the reader that sequences have no homology to extant apes, Neanderthal or other extinct species. Human sequences are amazingly close to Neanderthals, so nearly identical it was a challenge to tease them apart. How can there be no sequence similarity with the putative Sasquatch samples and/or what do they mean by that? How could a hypothetical species so close to modern humans to interbreed and produce viable, fertile offspring not share homology to the same entities in their extended family? Where did the sequences not in GenBank originate? None of this makes much sense to me and maybe they will see fit to explain it all carefully some day.
I just do not know, Guy. It is possible my colleague was able to get the ancillary data, so maybe she will have more to add.
So, the good news seems to be that samples are remarkably abundant, suggesting that independent corroboration should be possible soon. All I can add is that if it was me who held solid evidence of a new species and a remarkable pattern of origin, I would be breaking down the doors of any mainstream scientists I thought might be able to verify my data. I would want that Nobel prize far more than another appearance on Coast-to-Coast AM. So verification should be coming soon, right?
Best wishes.
Tyler
It should be noted we reached out to Dr. Melba Ketchum to see if she had any insight to any of these questions; we gave her ample time to respond and she did not have a comment at the time of this post.


Thanks for sharing this,Guy. The world of Bigfoot is changing. We may have quite a bit of answers,and still so much of the mystery remains. Just for a little longer,that may not be all that bad. : )
ReplyDeleteLol. Talk to Lloyd Pye about "Deep Throat DNA".
ReplyDeleteYes, and instead of beating down the doors of respected scientists who can back up her work, her supporters are portraying Sykes as some sort of enemy. Case in point - Scott Carpenter's recent blog.
ReplyDeleteWell a widely respected, credible evolutionary geneticist would be the enemy now wouldn't he . . ? The real mystery, at least in my eyes, is why anyone interested in this investigation took Ketchum seriously as events began to unfold. Cheers!
DeleteScott Carpenter of TN with all his blob squatches! LOL!
DeleteAnd lest I forget . . . Thank-you for this Guy. Cheers!
ReplyDeleteIf BF exists then she likely has real BF dna. She is in the drivers seat as the first to test and report on it publicly. Either Melba or her many detractors will be the laughing stock...time will tell.
ReplyDeleteI'm thinking the former . . . Cheers!
ReplyDeleteRe. the recently released paper on presumed Bigfoot/Sasquatch DNA by Dr. Melba Ketchum:
ReplyDeleteIt has been claimed that the Ketchum paper -- actually Ketchum, M. S., Wojtkiewicz, P. W., Watts, A. B., Spence, D. W., Holzenburg, A. K., Toler, D. G., Prychitko, T. M., Zhang, F., Bollinger, S., Shoulders, R., Smith, R. (2013) -- contains no raw data.
Only in a manner of speaking is this correct; the raw data is a supplement, accessible with a single click for anyone with the PDF file.
There are full raw data sequences for several samples, which I have just extracted as simple text and account for over 95 percent of all text, including text from a number of charts and tables that are also supplements. The total size of this simple text file is almost 9,000 kilobites. Each raw data set accounts for hundreds of pages of 12-point Arial type, line after line of amino acid sequences that look like this (modified from the original to avoid copyright infringement):
TGGGCTCAAGCAATCTTCCCTCCTCTGGGATAGATCTGTTCTAGACTACAGCACCATGCC
CGGCTAATTAAAAAAATTTTTAGTCTTCTGAGTAGTTTTTGTAGAGAAAATCATCATGCG
GCATCAGCTTGCCACATGTATCTCTCTCGCCCAGACTTGGAATCATACAACTATCTTGAT
CATGTGGAATTCAAGCGCTTTCGTTTTTTAGTCATTGAAGCAATCGATCTTTCCTTCTTA
(The four letters comprising the sequence data stand for the amino acids Adenine, Cytosine, Guanine, and Thymine. These four in their various combinations make up the genetic code.)
There are legitimate bases for critique of the Ketchum Sasquatch DNA study but this particular and often repeated claim of no raw data is groundless.
Not enough to tell anything Jim, and certainly not the whole genome of a new species she is claiming to have proven. We all have mutations, a small sequence shown out of context confirm anything but a small sequence from an individual.
Delete"...does not confirm anything"..... Love my new phone :/
DeleteCheers Nadia! She's claiming to have the entire genome mapped?
DeleteDo you believe that sequences of 2.7 million base pairs, 2.1 million base pairs and .5 million base pairs - of nuclear DNA - isn't enough to characterize a new species?
DeleteSome known person or primate could have those sequences, and it could be individual variation?
That sounds like an extraordinary claim.
Requiring extraordinary evidence, yes? Independent confirmation of her data is an absolute, hopefully forthcoming. Cheers!
DeleteAnon,
DeleteI was questioning Nadia Moore's assertion actually.
Looking worse as time goes by. Dr. Ketchum has cited a hoax paper in her work.
ReplyDeletehttp://www.cryptozoonews.com/ketchum-buffalo/
One thing after another keeps surfacing to put the credibility of the entire venture in severe jeopardy. She does credible researchers no favors.
the hoax paper quoted has nothing to do with the science presented. If you care about credibility, understand the context of what you are saying as a basis to discredit the paper
DeleteHere's context for you: In research, if mistakes are made in various aspects of the project, whether they are directly related to the data or not, they call into question the ability of the researcher to competently manage the project as a whole ... including the collection, management and interpretation of data. The onus of responsibility for presenting their findings competently rests squarely with the investigator. It all matters.
DeleteIndeed it does, well put. Cheers!
DeleteIt is sad that grown men/women have spent entire lives searching for something that really does’t exist.
ReplyDeleteLike, erm, god . . ? Cheers!
Delete"So, as Winter notes, he’s not sure if the researchers are inept or deliberate in their interpretation but some of the DNA is perfectly matched to humans and the rest is “crap”. Some of the sequences, he said, were far too short to be the result of hybridization, making Ketchums claim of hybridization from 15,000 years ago not plausible."
ReplyDeletehttp://doubtfulnews.com/2013/02/breaking-bio-on-the-ketchum-sasquatch-sequences/
A salient point I think. The whole issue of common ancestry is one that I'm not convinced she properly sorted, particularly if, as Nadia states above, she's claiming to have mapped the entire genome . . . Ah well. Cheers!
DeleteI'm sure they helped built the pyramids in Egypt in the old days. They're so strong and can move massive stone blocks...
Delete/sarc
Well duhh . . . Cheers!
DeleteThank you for the insight. My group is kind of confused, what does this mean. Ketchum says "proof" and no one can think of a good conspiracy theory for hiding Bigfoot. it's not like aliens we have to be afraid of. Point is, if this was truly definitive proof, wouldn't other scientists be leaping on the bandwagon? However, point is, science is something that can be proven or disproven. We need to accept that Bigfoot, if seen as a real being and not some peculiar paranormal spirit, can be proven. If other scientists begin to replicate this, and from her work it seems this should be easy as it's so abundant, it will really shake things up. It's a shame she just hasn't treated this like a science rather than a publicity stunt. Most scientists I know are lovely people that do the work they do not for money, but because they love doing science. (They don't make a huge salary). They would love to talk to Ketchum, agreeing or not. If she's done the science correctly, they are going to back her up. They will challenge her, as all papers and claims have to go through the "PROVE IT!" questions from fellow scientists. She has to do what any other scientists has to do, be open with her work and defend it. My own daughter has her PhD and she has to defend her work to get funding. Scientists aren't used to people saying "well wow, that's wonderful!" they are used to "I'm going to have to replicate this work before I will believe it". She's not making it easy. And by defending I mean, showing them the science, not talking to some radio host!
ReplyDeleteMy beef with mainstream academia is that they have their status quo so things progress so slow and not always been upfront honest about how they do things. There's a saying where science progresses when a scientist dies...
DeleteEasy, I think, to get frustrated with 'science', all that irritating methodology, you know -- testable hypotheses, replication, independent verification, and so on and on and on . . . But when one ponders the alternative, to wit: inflexible orthodoxy, it's an irritation that I, for one, am grateful for . . . Cheers!
ReplyDelete